Total RNA from pre-treated monocytes was isolated using the RNA Miniprep Kit from Stratagene (La Jolla, CA), according to the recommendations of the manufacturer. One microgram of total RNA was reverse transcribed using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA) to generate cDNA. To identify the housekeeping genes that maintain constant expression levels in our experimental settings, the expression stability of 32 housekeeping genes was pre-evaluated using human TaqMan Gene Expression Endogenous Control Plate (Applied Biosystems). For both TaqMan Gene Expression PLX4032 Endogenous Control and Multigene

TaqMan arrays the real-time PCR were performed in the format of 96-well plates on ABI PRISM 7900HT Fast Real-Time PCR System (Applied Biosystems). The cDNA was amplified with TaqMan Universal PCR Master Mix (Applied Biosystems) for 40 cycles using universal cycling conditions (95° for 10 min followed by 40 cycles at 95° for 15 seconds and 60° for 1 min). For profiling of individual control genes such as tumour necrosis factor-α (TNF-α) and interleukin-12p40 (IL-12p40), the primers were designed using primer express 2.x software (Applied Biosystems). Sequences of primers to detect TNF-α were described previously,[14]the

sequences of primers for IL12p40 were forward: CTTCTTCATCAGGGACATCAT CAA, reversed: Protein Tyrosine Kinase inhibitor GGGAGAAGTAGGAATGTGGAGTACTC,probe: FAMCAGGTGGAGGTCAGCTGGGAGTACCC-Tamra. For relative quantification, data were analysed by the ΔΔCT method using SDS 2·3. (Applied Biosystems) and by Data Assist v2·0. Expression levels of target genes were normalized to the average of housekeeping genes. Ingenuity Pathway Analysis (ipa) software (http://www.ingenuity.com) is a proprietary web-based database that provides information on gene and protein interactions based on the published literature. In this study, the data-driven, n-butyrate-affected Pregnenolone eicosanoid-associated gene network was delineated using the ipa software; core analysis was used to identify the

most significantly affected biological processes. For intracellular determination of COX-1 and COX-2 by flow cytometry, stimulated monocytes were fixed with 2% formaldehyde, permeabilized with 0·1% saponin, and stained with anti-COX-1-FITC/anti-COX-2-phycoerythrin (BD, San Jose, CA). For analysis of mitogen-activated protein kinase (MAPK) activation cells were incubated after fixation and permeabilization with antibodies to the phosphorylated forms of the kinases: anti-p-p38 MAPK (pT180/pY182) (BD Biosciences, Franklin Lakes, NJ), anti-p-p44/42 MAPK (Erk1/2) (Thr202/Tyr204), anti-p-SAPK/JNK (Thr183/Tyr185), (both Cell Signaling Technology, Boston, MA). The cells were analysed on a FACSCalibur (BD Biosciences).

A look was coded if infants looked at the ottoman following the mention of a hidden object. A point was coded if infants looked and raised their arm in the direction of the ottoman. Both index finger and full-hand pointing were considered. Approaching the ottoman was coded if the baby looked at the ottoman and moved their body toward the ottoman. Videotapes of the sessions (representing 71% of the sessions) were then coded by a second coder who was blind to the hypothesis of the study and to the condition.

The coder was not blind to the position of the ottoman because it was partially visible on the tapes. Overall Selleckchem BIBW2992 agreement on the presence or absence of target behaviors was high (94%, Cohen’s kappa 0.88). Disagreements were resolved via discussion, and the experimenter’s GS-1101 cell line initial judgments were used in the analyses below. The purpose of this experiment was to investigate why infants have difficulty orienting to a hidden toy’s location after having seen this toy in an adjacent room. We predicted that infants would perform at similarly high levels with the new and a familiar toy in the identifying feature condition. In the nonidentifying

feature and the no feature conditions, we predicted high performance with the new toy and poor performance with the familiar toy. Results are displayed in Figure 1. As a first step, to ensure that infants were equally attentive in the three familiar toy conditions, we analyzed the time they looked Arachidonate 15-lipoxygenase at the object when the experimenter highlighted the object or its feature during the familiarization phase. Data from one participant in the identifying feature condition were excluded from this and all other analyses because the infant focused on the object more than 2.5 standard deviations longer than average. A one-way Welch ANOVA1 revealed no difference in how long infants looked at the object across the three conditions during the feature

introduction, F (2, 28.65) = 1.97, p = 0.16, (identifying feature: M = 9.53 sec, SE = 1.06, nonidentifying feature: M = 9.25 sec, SE = 0.71, no feature: M = 7.58 sec, SE = 0.64). Importantly, how long infants looked at the object during the familiarization did not predict whether infants responded or not to the familiar toy in the test phase (logistic regression, β = 0.003, p = 0.43). This suggests that any differences in infants’ responses to a familiar object across conditions cannot be explained by differences in their attention during the familiarization phase. Further analyses of infants’ responses in the test phase revealed no effects of gender, side, or toy order. Boys were as responsive as girls, and neither the side where a toy was hidden, nor the order of the familiar and the new toy conditions mattered for infants’ ability to respond. There was also no interaction between condition and order.