Table 1 Sequences of the primers used
for qPCR of transcripts coding for SGK1 (all four isoforms), for each of the four isoforms and for glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Gene Symbol Accession Number Sense Primer Antisense Primer SGK1 (all 4 isoforms) N/A AGGGCAGTTTTGGAAAGGTT CTGTAAAACTTTGACTGCATAGAACA SGK1 (isoform 1) NM_005627.3 GGCACCCTCACTTACTCCAG GGCAATCTTCTGAATAAAGTCGTT SGK1 (isoform 2) NM_001143676.1 CGGTGGAAAATGGTAAACAAA CTTGATCCACCTTCGTACCC SGK1 (isoform 3) NM_001143677.1 GAAGCTATAAAACCCCCTTTGAA GGCAATCTTCTGAATAAAGTCGTT SGK1 (isoform 4) NM_001143678.1 CTTCCTGCTGAGCGGACT GGCAATCTTCTGAATAAAGTCGTT GAPDH NM_002046 selleck inhibitor AGCCACATCGCTCAGACA GCCCAATACGACCAAATCC Histological examination and IHC The histological diagnosis was re-evaluated in 2 μm FFPE sections after routine laboratory haematoxylin/eosin staining. IHC Ferrostatin-1 mouse analysis was done as described [11], omitting the antigen retrieval
PF-01367338 research buy step, and using a primary monoclonal antibody for SGK1 (sc-28338, Santa Cruz Biotechnology, Inc. Santa Cruz, CA), applied overnight (O.N.) at 4°C at a dilution of 1:300. Phospho-SGK1 (pSGK1 Ser422) was detected by means of a rabbit polyclonal antibody (sc-16745, Santa Cruz Biotechnology) applied for 2 h at 4°C at a dilution of 1:100). For both antibodies, optimal working dilution was defined on the basis over of titration experiments. The secondary antibody solution and streptavidin-biotin, both contained in the QP900-9L kit (BioGenex, San Ramon, CA.), were applied according to the manufacturer’s instructions. Finally, 3-amino-9-ethylcarbazide (AEC substrate kit, ScyTek, Logan, UT) was used as chromogen. Mayer’s haematoxylin was used for the nuclear counterstaining.
Negative controls for each tissue section were prepared by omitting the primary antibody. Scoring and quantification of mRNA expression and immunoreactivity mRNA expression Progression of the qPCR reaction, performed using the primer pairs specified in Table 1, was monitored. All the experiments were performed in quadruplicate. Immunoreactivity Two examiners (P.V. and M.G.P.) evaluated independently the staining pattern of SGK1 and phospho-SGK1, with subsequent discussion for the cases in which divergent diagnoses were given. According to the amount of staining, cases were classified in tertiles as follows: a) negative/low; b) medium; c) high. Statistical analysis For quantitative variables, average values were determined, and the non-parametric Mann-Whitney U-test was applied to evaluate statistical significance. All categorical variables were tested for statistical significance by using Pearson’s χ2 test or Fisher’s exact test.