Such was the nature of the largely logistic problems encountered. The food supplies of the hospital were soon depleted too because not only patients had to be fed, but all people taking refuge in the hospital. Record keeping was haphazard. Some patients had no medical records. Some had but these were incomplete. Personnel who attended to patients with trivial injuries often moved on to other patients without documenting. Only those who went on to have surgery had detailed and accurate documentation of their treatment. Poor record keeping is ubiquitous in the management of mass casualties but accurate record Cilengitide keeping ensures continuity of care, avoids duplication

of efforts, and allows a retrospective analysis of the response effort at debriefing [2, 7]. It is recommended Sirtuin inhibitor that tags (which may be laminated) should be used for identification and teams trained to use short forms and concise writing in keeping patient records under such situations [1, 7]. Hospital personnel who were QNZ in vitro trapped in the hospital for over 72 hours soon began to manifest features of physical and mental stress. Overwork was a major factor, but in addition, there was anxiety for personal safety, fear for the lives of

loved ones, and worry over the eventual outcome of the crisis. The sight of severely injured casualties often with grotesque wounds, and the charred, dismembered corpses deposited on the floor outside the morgue (the morgue itself was filled beyond capacity) contributed to the stress. Some people too had narrowly escaped death at the hands of rampaging mobs, prior to finding refuge in the hospital. Acute stress disorders and have been known to accompany the experiencing of such traumatic events and could be a forerunner of Post Traumatic Stress Disorder (PTSD).

Although more commonly described among survivors almost (direct victims) of disasters [2], it has been found among indirect victims such as first responders and the general public [10] and the need for disaster plans to incorporate provisions for emotional evaluation and rehabilitation of casualties is increasingly advocated [2, 7]. The Jos crisis of 2001 was in part a religious one. Tensions flared periodically between Christians and Muslims on the premises, due to the mixed composition of the large numbers of people seeking refuge there. Most people, including personnel invariably found their sentiments swayed to on one side of the divide or the other and the ensuing tension threatened to degenerate into violence. It took the dexterity of top management and senior staff to douse the tensions and focus all efforts on the emergency response while emphasizing the need to maintain neutrality in the hospital. Despite this, rumors that victims identified with a particular section were being discriminated against led to an attempt by some rioters to attack the hospital. The perimeter fence of the hospital was already breached before attack was repelled by military personnel guarding the premises.

During extubation the patient should be monitored closely and the care providers should be prepared for buy Ro 61-8048 the possibility of re-intubation. In a case of tracheotomy tube, the patient may be awakened and allowed to breathe spontaneously through the tracheostomy tube for a few days, providing a safer recovery. Conclusion Airway management of the maxillofacial trauma patient is

complex and requires both sound judgement and considerable experience, which are gained in similar emergency situations. Skilful and experienced personnel are mandatory, as is collaboration by the anesthesiologist, maxillofacial surgeon, ENT specialist or general surgeon, in order to have an outcome with minimal risks and maximal success. It is important to remember that timely, decisive and skillful management of the airway can often make the difference between life and death or between ability and disability in such situations. Consent Written informed consent

was obtained from the patient for publication of the publication of their case reports and accompanying images. A copy of the written consent is available for review by the Editor-in-Chief PSI-7977 in vivo of this journal. References 1. American College of Surgeons Committee on Trauma: Advanced Trauma Life Support for Doctors ATLS. 7th edition. Chicago, IL; American College of Surgeons; 2004. 2. Walls RM: Management of the difficult airway in the trauma patient. Emerg Med Clin North Am 1998, 16:45–61.CrossRefPubMed 3. Domino KB, Posner KL, Caplan RA, Cheney FW: Airway injury during anesthesia: a closed claims analysis. Anesthesiology 1999, 91:1703–1711.CrossRefPubMed 4. Peterson GN, Domino KB, Caplan RA, Posner KL, Lee LA, Cheney FW: Management of the difficult airway: a closed claims analysis. Anesthesiology 2005, 103:33–39.CrossRefPubMed 5. Garcia A: Critical care issues in the early management of severe trauma. Surg Clin North Am 2006, 86:1359–1387.CrossRefPubMed 6. Gruen RL, Jurkovich GJ, McIntyre LK, Foy HM, Maier RV: Patterns

of errors contributing Rolziracetam to trauma mortality: lessons learned from 2,594 deaths. Ann Surg 2006, 244:371–380.PubMed 7. Hutchison I, Lawlor M, Skinner D: ABC of major trauma. Major maxillofacial injuries. BMJ 1990, 301:595–599.CrossRefPubMed 8. Crosby ET: Airway management in adults after cervical spine trauma. Anesthesiology 2006, 104:1293–1318.CrossRefPubMed 9. Manoach S, Paladino L: Manual in-line stabilization for acute airway management of suspected cervical spine injury: Ipatasertib order historical review and current questions. Ann Emerg Med 2007, 50:236–245.CrossRefPubMed 10. Santoni BG, Hindman BJ, Puttlitz CM, Weeks JB, Johnson N, Maktabi MA, Todd MM: Manual in-line stabilization increases pressures applied by the laryngoscope blade during direct laryngoscopy and orotracheal intubation. Anesthesiology 2009, 110:24–31.CrossRefPubMed 11.

Immunization

assay and protection assay in adult Balb/c mice All procedures involving animals were approved by the Animal Experimentation Ethics Committee of Sun Yat-sen University and carried out by a licensed individual with an ethical approval number of 2012/0081. Animals were purchased from the Center of Experimental Animal of the Sun Yat-Sen University. Four groups (PL10 coupled to KLH, PH10 coupled to KLH, PM10 coupled to KLH, and PBS), each comprising of ten adult female Balb/c mice (4–6weeks old), were intraperitoneally injected with 100 μg of immunogen emulsified in complete Freund’s adjuvant for the first immunization. Mice were then injected at week 2 and 4 with the peptides and Freund’s ATM/ATR inhibitor incomplete adjuvant. The mice were bled on week 0, 2, 4 and 6 via tail vein according to NC3Rs 17DMAG standard procedures, and the anti-peptide antibody titer of mice sera was determined by ELISA. Two weeks after the last immunization, mice were infected with DENV2 NGC strain (106 PFU/mouse) through peritoneal injection. Blood samples were collected at day 0.25, 1, 2, 3, 4 and 5 via tail vein according to NC3Rs standard procedures. Then, all animals

were euthanized by using Carbon dioxide (CO2) according to NC3Rs standard procedures and the experiment was terminated. Viral RNA was extracted from 140 μl serum aliquots using QIAamp Viral RNA mini kit (Qiagen). The viral RNA copy numbers were quantified

by qRT-PCR. Western blot analysis DENV infected C6/36 cells were treated with 1% triton X-100, the lysates were run on 12% SDS polyacryramide gels and selleckchem transferred Uroporphyrinogen III synthase onto polyvinylidene difluoride (PVDF) membranes (Amersham). The membranes were then blocked with PBS containing 5% skimmed milk and probed with prM-specific antibodies for 2 h at room temperature. Subsequently, membranes were detected with HRP-conjugated anti-mouse IgG and developed with enhanced chemiluminescence reagents (ECL, Thermo Fisher Scientific). Indirect immunofluorescence assay (IFA) C6/36 cells were infected with DENV1-4 and JEV. Cells were then fixed with acetone at −20°C for 20 min and washed three times with PBS. Cells were incubated with a 100-fold dilution of prM-specific antibodies. After 60 min of incubation at 37°C, cells were washed three times with PBS. Cells were then reacted with a 200-fold dilution of Alexa-Fluor-488-conjugated anti–mouse IgG (Invitrogen) for 45 min at 37°C, washed five times with PBS. After washing, cells were treated with DAPI and detected using a fluorescent microscope. Real-time quantitative RT-PCR (qRT-PCR) Viral RNA copy numbers were quantified by qRT-PCR as described previously [52]. Briefly, Viral RNA was extracted from 140 μl serum aliquots using QIAamp Viral RNA mini kit (Qiagen).

RT-PCR and real-time RT-PCR RT-PCR and real-time RT-PCR analysis were performed as described previously [24]. The primers and

probes for RT-PCR and the real-time RT-PCR were designed with Primer Express v 2.0 (Applied Biosystems, Inc.) and provided in Table 1. Table 1 Primer Sequences Used for Reverse Transcription-PCR and Real-time Quantitative RT-PCR (5′ to 3′)   Gene Forward primer Reverse primer Probe RT-PCR CENP-H TGCAAGAAAAGCAAATCGAA ATCCCAAGATTCCTGCTGTG     GAPDH CCACCCATGGCAAATTCCATGGCA TCTAGACGGCAGGTCAGGTCCAC   Real-time PCR CENP-H CCTTATTTTGGGGAGTAAAGTCAAT ACAAATGCACAGAAGTATTCCAAAT MK-8776 FAM-TTCCTTAAGGGCAGGATCCT-TAMRA   GAPDH GACTCATGACCACAGTCCATGC AGAGGCAGGGATGATGTTCTG S3I-201 datasheet FAM-CATCACTGCCACCCAGAAGACTGTG-TAMRA Full gene names: CENP-H, centromere protein H;GAPDH, glyceraldehyde-3-phosphate dehydrogenase Western blot Western blot analysis was performed as described previously[15, 24] using anti-CENP-H (Bethyl Laboratories, Montgomery, Texas, USA), anti-α-Tubulin (Sigma, Saint Louis, Michigan, USA), anti-p21, anti-p27 and anti-Rb antibodies (Cell Signaling, Danvers, Massachusetts, USA). Immunohistochemical analysis The staining procedures and result measure of CENP-H were done as described previously[15, 24]. The cells at each intensity of staining

selleckchem were recorded on a scale of 0 (no staining), 1 (weak staining = light yellow), 2 (moderate staining = yellowish brown), and 3 (strong staining = brown). An intensity score of ≥ 2 with at least 50% of malignant cells with positive CENP-H staining was used to classify tumors with high expression, and < 50% of malignant cells with nuclear staining DAPT in vitro or < 2 intensity score classified tumors with low expression of CENP-H. MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide) assay Growing cells (5 × 103 per well) were seeded into 96-well plates. Cells were stained with 100 μl sterile MTT dye (0.5 mg/ml, Sigma, St. Louis, Missouri, USA) at each time point, followed by additional incubation for 4 h at 37°C. After removal of the culture medium from each well, 150 μl of dimethyl sulphoxide

(Sigma, St. Louis, MO, USA) was added and thoroughly mixed for 15 min. The optical density was read at 570 nm using a microplate reader (Bio-Rad 3500, Hercules, California, USA), with 655 nm as the reference wavelength. All experiments were performed in triplicate. Colony formation assays Cells were seeded in 6-well plates (1×103 cells per well) and cultured for two weeks. The colonies were fixed with methanol for 10 min and stained with 1% crystal violet for 1 min. Each group of cells was performed in triplicate. Bromodeoxyuridine (BrdU) incorporation and immunofluorescence Cells grown on cover slips (Fisher, Pittsburgh, Pennsylvania, USA) were synchronized by serum starvation (0.5%FBS) for 48 h and then released into serum-containing medium for 4 h.

These variables contributed to 62% of the variance in the community structure but significant associations between the microbial community structures were limited to culture-positive sputum (P = 0.05), the isolation of H. influenzae (P = 0.002) and the isolation of P. aeruginosa (P = 0.002) (Figure 1B). Repeating these Dorsomorphin chemical structure analyses at putative species level resolution found the same result, with only these three variables

showing significant associations with the bacterial community structure. The presence of culturable H. influenzae and culturable P. aeruginosa exerting significant effects on community structure 3-MA nmr was supported by examination of the read numbers of these taxa in the pyrosequencing analysis. When one species was present (with one exception, patient 63), then the other species did not contribute more than 1.5% to the total bacterial community profile (Additional file 2: Figure S1). The other variables analysed were the presence of an exacerbation at time of sampling; 12 month history of persistent; intermittent or absence of culturable P. aeruginosa; current azithromycin treatment; current nebulised colistin treatment; gender, FEV1% predicted; antibiotic treatment in previous month and age. None were found to significantly affect the community structure

in either the total or frequently exacerbating cohorts. Of particular interest were 25 patients that had not received antibiotics for one month prior to sample collection. Ordination analyses (Figure 1A) showed that these individuals did not have significantly different bacterial Avapritinib clinical trial communities to those who were receiving antibiotic therapy. Bacterial community structure and clinical status For partial least squares discriminant analysis (PLS-DA), samples were classified according to exacerbation status with group 1 (n = 50) being stable and Ketotifen group 2 (n = 20) exacerbating at time of sampling. The model made no further assumptions about each patient group. Analysis of the scatter plot of scores (Figure 2), demonstrated that 8 individuals from the

exacerbating group (40%) had bacterial community structures that were distinct from those of the remaining patients. Within the 20 individuals sampled during an exacerbation, 12 patients exhibited a community composition that was similar to 22 patients who were stable at time of sampling in terms of projection in the XY space. The remaining 28 stable patients had a community composition that was distinct from the remaining 8 exacerbation patients (Figure 2). Figure 2 Partial least squares discriminant analysis (PLS-DA) loading plot based on the relative abundance of bacterial taxa determined by 454 sequence analysis of the microbiota of sputum from patients reporting current stability (green circle) and sputum from patients reporting a current exacerbation (blue circle). PLS1 (R 2 X = 0.169, R 2 Y = 0.232, Q 2  = 0.0287) and PLS 2 (R 2 X = 0.107, R 2 Y = 0.124, Q 2  = 0.0601) are given.

Climate change can impact on the range dynamics of species and can induce shifts in their distribution patterns. Understanding

and quantifying such climate change induced range shifts is important for conservation management and the planning of biotope corridors, but also for evaluating effects on newly AZD1480 mouse colonized habitats and for guiding adaptation measures. In the first paper of this issue, Buse et al. (2013) reconstructed the immigration of the oak-inhabiting jewel beetle Coraebus florentinus from Mediterranean forest ecosystems to Germany since the 1950s. Using three independent modelling approaches they analysed abiotic factors which determine the current spatial distribution of the beetle in southwest Germany. The authors link the range extension to the main factors of “mean maximum temperature” and “mean precipitation” in summer, which have both been altered by climate change see more during recent decades. The warmer and dryer conditions in southwest Germany favoured the reproduction and enabled the migration success of Coraebus florentinus. Considering current projections of climate change, the jewel beetle is expected to extend its range further north into Central Europe in the future and

might particularly affect young oak stands on sandy and dry sites. This https://www.selleckchem.com/products/ly2606368.html calls for an adaptation of forest management for the conservation of species-rich oak stands and a revision of the conservation status and categorization of the beetle as a Tacrolimus (FK506) critically endangered species in Germany. The direct and indirect impacts of climatic alterations on Mediterranean forest ecosystems in Greece are the subject of the study by Chrysopolitou et al. (2013). Greece is projected to be among the most vulnerable countries to climate change in Europe. In this context, the presented study of climate change effects on the appearance

of fungal pathogens and bark beetle populations as well as on woody vegetation composition could be a valuable contribution to the development of adaptation measures in Mediterranean forest ecosystems in general. The authors collected evidence for the link between alterations in temperature and precipitation regimes and the outbreaks of pathogens, which jointly caused the dieback of tree species (especially conifer species), in four different mountainous study areas in Greece. However, the impacts on tree species composition have varied between the different study areas which in turn calls for the development of regionalized adaptation measures within forest and conservation management and further research on the underlying driving forces. The subsequent three papers focus on adaptation strategies and measures for forest and conservation management aimed at mitigating the impacts of climate change on forest biodiversity.

Authors’ contributions XW and XX proposed the research work, coordinated the collaboration, carried out the analyses of experimental results, and drafted the manuscript.

JH designed the experiment and experimental setup and carried out the measurements. RZ and MS participated in experimental measurements, results and discussion, and analyses. All authors read and approved the final manuscript.”
“Background ZnO is a low-cost and widely used semiconductor material with outstanding physical and chemical characteristics. At room temperature, the band gap and exciton binding energy of ZnO are 3.37 eV and 60 meV, respectively, both contributing to its extraordinary chemical and thermal stability. Thus, ZnO thin films exhibit magnificent applications in the manufacturing process of optoCB-839 nmr electronic devices [1]. Also, being a promising semiconductor material that is transparent to visible light and has AR-13324 in vitro excellent optical transmittance, TiO2 is widely used in the synthesis of semiconductor photocatalysts, solar cell electrodes, and sophisticated electronic optical devices [2–5]. ZnO and TiO2 thin films, both with a wide band gap, high refractive index, high stability, and good catalysis, are suitable partners for multilayer nanostructures. On the one hand, TiO2 could serve as a buffer layer between ZnO and Si substrates. The lattice and thermal mismatches can be reduced,

and the quality of ZnO films will be JIB04 ic50 enhanced because TiO2 can inhibit the surface silicon atoms from plundering oxygen atoms in ZnO films [6, 7]. Moreover, growing very thin ZnO films over a porous TiO2 electrode can improve the surface state and surface atomic mobility, so high-powered solar cells with better utilization efficiency PIK3C2G can be produced [8]. There are also researches on ZnO/TiO2 multilayer

mirrors at ‘water-window’ wavelengths with high reflectivity around 2.7 nm, indicating its potential in multilayer optics [9]. ZnO/TiO2 multilayers have been prepared by many techniques, such as chemical vapor deposition, pulsed laser deposition, and co-sputtering [10–12]. However, high-quality nanolaminate films require precisely controlled factors including interfacial roughness, interdiffusion between layers, layer-to-layer consistency, and conformality. Atomic layer deposition (ALD) is more powerful in preparing such multilayers than other techniques, which keeps the precursors separated during the reaction [13]. By sequentially dosing the surface with appropriate chemical precursors and then promoting surface reactions that are inherently self-limiting, the atomic layer control of film growth can be obtained. There has been a variety of publications on ALD-prepared ZnO or TiO2 films [14–17]. Thus, studies on ZnO/TiO2 multilayers prepared by ALD are of increasing importance in this field [18, 19]. In this study, a series of ZnO/TiO2 nanolaminates were prepared by ALD.

PubMedCrossRef 18. Pulitzer JF, Colombo M, Ciaramella M: New control elements of bacteriophage T4 pre-replicative transcription. BAY 80-6946 Journal of Molecular Biology 1985, 182:249–263.PubMedCrossRef 19. Kim JS, Davidson N: Electron microscope heteroduplex study of sequence relations of T2, T4, and T6 bacteriophage DNAs. Virology 1974, 57:93–111.PubMedCrossRef 20. Ackermann H-W, Krisch HM: A catalogue of T4-type bacteriophages. Archives

of Virology 1997, 142:2329–2345.PubMedCrossRef 21. Ackermann H-W, DuBow MS: Viruses of Prokaryotes Boca Raton, FL: CRC Press 1987. 22. Ackermann H-W, Kasatiya SS, Kawata T, Koga T, Lee JV, Mbiguino A, Newman FS, Vieu JF, Zachary A: Classification of Vibrio bacteriophages. Intervirology 1984, 22:61–71.PubMedCrossRef 23.

Tétart F, GF120918 research buy Desplats C, Kutateladze M, Monod C, Ackermann H-W, Krisch HM: Phylogeny of the major head and tail genes of the wide-ranging T4-type bacteriophages. Journal of Bacteriology 2001, 183:358–366.PubMedCrossRef 24. Desplats C, Krisch HM: The diversity and evolution of the T4-type bacteriophages. Research in Microbiology 2003, 154:259–267.PubMedCrossRef 25. Hambly E, Tétart F, Desplats C, Wilson WH, Krisch HM, Mann NH: A conserved genetic module that encodes the major virion components in both the coliphage T4 and the marine cyanophage S-PM2. Proceedings of the National BIBF 1120 Academy of Sciences of the United States of America 2001, 98:11411–11416.PubMedCrossRef tetracosactide 26. Short CM, Suttle CA, Short CM, Suttle CA: Nearly identical bacteriophage structural gene sequences are widely distributed in both marine and freshwater environments. Applied & Environmental Microbiology 2005, 71:480–486.CrossRef 27. Sharon I, Tzahor S, Williamson S, Shmoish M, Man-Aharonovich D, Rusch DB, Yooseph S, Zeidner G, Golden SS, Mackey SR, Adir N, Weingart U, Horn D, Venter JC, Mandel-Gutfreund Y, Beja O: Viral photosynthetic reaction center genes and transcripts in the marine environment. ISME Journal 2007, 1:492–501.PubMedCrossRef 28. Tzahor S, Man-Aharonovich D, Kirkup BC, Yogev T, Berman-Frank

I, Polz MF, Beja O, Mandel-Gutfreund Y: A supervised learning approach for taxonomic classification of core-photosystem-II genes and transcripts in the marine environment. BMC Genomics 2009, 10:229.PubMedCrossRef 29. Comeau AM, Krisch HM: The capsid of the T4 phage superfamily: The evolution, diversity, and structure of some of the most prevalent proteins in the biosphere. Molecular Biology & Evolution 2008, 25:1321–1332.CrossRef 30. Blondal T, Hjorleifsdottir SH, Fridjonsson OF, Aevarsson A, Skirnisdottir S, Hermannsdottir AG, Hreggvidsson GO, Smith AV, Kristjansson JK: Discovery and characterization of a thermostable bacteriophage RNA ligase homologous to T4 RNA ligase 1. Nucleic Acids Research 2003, 31:7247–7254.PubMedCrossRef 31. Bertani G: Studies on lysogenesis. I. The mode of phage liberation by lysogenic Escherichia coli. Journal of Bacteriology 1951, 62:293–300.PubMed 32.

1999; Sivinski et al. 2000, 2001). These tephritids are mostly native species of no economic importance that breed in fruits of a variety of uncultivated trees. The fruit of such trees serve as sources of parasitoids that

can move and attack the target pest on its non-commercial and commercial hosts. We term such trees “parasitoid reservoir plants”, some of Selleckchem 3MA which serve as hosts for several non-pest fly species that are parasitized by 1–3 species of generalist parasitoids (see Tables 2, 3). For example, the native non-pest fruit fly Anastrepha alveata Stone develops in the fruit of the native reservoir plant Ximenia americana (Olacaceae). This fly is a host for three generalist native braconids, Doryctobracon areolatus (Szépligeti), Utetes anastrephae (Viereck), and Opius hirtus Fischer (Lopez et al. 1999),

the first two of which are the dominant species in the natural enemy guild attacking the pestiferous A. obliqua. Pest-based parasitoid reservoir plants Useful parasitoids are sometimes Avapritinib in vitro produced in fruit flies that are pests in other regions but not locally. For example, in the mango production region of Veracruz, Mexico, neither A. ludens (a key pest of citrus) nor Anastrepha striata Schiner (a pest of guava [Psidium guajava]) are of concern because neither citrus nor guava are grown commercially in the region. Both species of tephritids are attacked by parasitoids that also attack A. obliqua, the major fruit fly pest of mangoes. Therefore under these particular circumstances citrus and guava serve as natural enemy reservoir plants, termed here “pest-based parasitoid reservoir plants”. In

small-fruited pest-based parasitoid reservoir plants (e.g., P. guajava, Psidium guineense Sw.) tephritids are parasitized at moderate to high rates (30–75 %) by five native and two exotic species of generalist parasitoids (Tables 2, 3; Lopez et al. 1999; Sivinski et al. 2000). In citrus-producing regions, A. obliqua and A. ludens switch biological control roles, with tropical plums (Spondias spp.) infested with A. obliqua becoming a pest-based reservoir for parasitoids of A. ludens in smaller diameter citrus Ketotifen or non-commercial fruit which helps reduce populations present in larger commercially grown citrus. Vulnerabilities of fruit trees useful to biological control and conservation Habitat loss is a major threat to species persistence (Fischer and Lindenmayer 2007; Mortelliti et al. 2010). In terms of trees useful to biological control and conservation, the effects of habitat loss can be examined at the levels of both the landscape and of the individual tree. At the landscape-scale, deforestation and PI3K Inhibitor Library research buy forest fragmentation pose major threats while on the scale of individual trees, selective logging endangers parasitoid reservoirs.

Science 1997, 278:1928–1931.CrossRef 67. Thielges MC, Fayer MD: Protein dynamics studied with ultrafast two-dimensional infrared vibrational echo spectroscopy. Accounts Chem Res 2012, 45:1866–1874.CrossRef 68. Mouthuy P-O, Coulombier M, Pardoen T, Raskin J-P, Jonas AM: Overcurvature describes the buckling

and folding of rings from curved origami to foldable tents. Nat Commun 2012, 3:1290.CrossRef 69. Rutter JW: Geometry of Curves. Boca Raton: Chapman & Hall; 2000. 70. Landau LD, Lifshitz EM: JNK-IN-8 purchase Theory of Elasticity. 2nd English edn. Oxford: Pergamon Press; 1970. 71. Grosberg AIU, Khokhlov AR: Statistical Physics of Macromolecules. New York: AIP Press; 1994. 72. Yamakawa H: Modern Theory of Polymer Solutions. New York: Harper & Row; 1971. 73. Hagerman PJ: Flexibility of DNA. Annu Rev Biophys Bio 1988, 17:265–286.CrossRef 74. Brinkers eFT508 molecular weight S, Dietrich HRC, De Groote FH, Young IT, Rieger B: The persistence length of double stranded DNA determined using dark field tethered particle motion. J Chem Phys 2009, 130:215105.CrossRef 75. Moras G, Pastewka L, Walter M, Schnagl J, Gumbsch P,

Moseler M: Progressive shortening of sp-hybridized carbon chains through oxygen-induced cleavage. J Phys Chem C 2011, 115:24653–24661.CrossRef 76. Semsey S, Virnik K, Adhya S: A gamut of loops: meandering DNA. Trends Biochem Sci 2005, 30:334–341.CrossRef 77. Zhang Y, McEwen AE, Crothers DM, Levene Org 27569 SD: Statistical-mechanical theory of DNA looping. Biophys J 2006, 90:1903–1912.CrossRef 78. Castelli IE, Ferri N, Onida G, Manini N: Carbon sp chains in graphene nanoholes. J Phys-Condens Mat 2012, 24:104019.CrossRef 79. Xu B, Lin JY, Lim SH, Feng YP: Structural and electronic properties of BIRB 796 cost finite carbon chains encapsulated into carbon nanotubes. J Phys Chem

C 2009, 113:21314–21318.CrossRef 80. Zhao XL, Ando Y, Liu Y, Jinno M, Suzuki T: Carbon nanowire made of a long linear carbon chain inserted inside a multiwalled carbon nanotube. Phys Rev Lett 2003, 90:187401.CrossRef Competing interests The author declares no competing interests.”
“Background Much of the recent effort to develop photovoltaics (PV) has focused on third-generation PV. The third-generation PV is defined by cost and power conversion efficiency (PCE) greater than the Shockley-Queisser limit of 32% [1]. It can be reached through device architecture innovations, multiple-carrier generation using impact ionization, and new materials. Colloidal quantum dots (CQDs) have been proposed as useful materials for third-generation PV because of their ability to generate multiple excitons. Also, by changing the physical dimensions of CQDs, band gaps can be tuned from the visible to the infrared region using low-cost solution-processed fabrication. CQD PV has been studied in various ways using the following: Schottky CQD solar cells [2], depleted heterojunction CQD solar cells [3], and CQD-sensitized solar cells [4].